Cellulaire veroudering bij hepatocellulair carcinoom geïnduceerd door een lang niet-coderend RNA-gecodeerd peptide PINT87aa door FOXM1-gemedieerde PHB2 te blokkeren

Rationale:  Onlangs is aangetoond dat lange niet-coderende RNA’s (lncRNA’s), waarvan bekend is dat ze betrokken zijn bij de progressie van kanker bij de mens, coderen voor peptiden met biologische functies, maar de rol van door lncRNA gecodeerde peptiden bij cellulaire veroudering is grotendeels onontgonnen. We rapporteerden eerder de tumor-onderdrukkende rol van PINT87aa, een peptide dat wordt gecodeerd door het lange intergene niet-eiwit coderende RNA, p53-geïnduceerde transcript ( LINC-PINT).  Hier hebben we de rol van PINT87aa bij cellulaire senescentie van hepatocellulair carcinoom (HCC) onderzocht.

Methoden:  We onderzochten de functies van PINT87aa en afgeknotte PINT87aa  in vitro  door celproliferatie te volgen en voerden flowcytometrie uit, senescentie-geassocieerde β-galactosidase-kleuring, JC-1-kleuring die indicatief is voor mitochondriaal membraanpotentieel, de verhouding van het overlappende gebied van lichte keten Three bèta ( LC3B) en mitochondriale sondes en de verhouding van lysosomaal geassocieerd membraaneiwit 1 (LAMP1) overlapt met cytochroom c-oxidase-subeenheid 4I1 (COXIV) die mitofagie aangeeft. PINT87aa en afgeknotte PINT87aa-functies  in vivo werden geverifieerd door subcutaan getransplanteerde tumoren in naakte muizen. De mogelijke binding tussen PINT87aa en forkhead subject M1 (FOXM1) werd voorspeld door middel van structurele analyse en geverifieerd door co-immunoprecipitatie en immunofluorescentie co-lokalisatie. Rescue-experimenten werden  in vivo en in vitro uitgevoerd  na overexpressie van FOXM1. Verder werden chromatine-immunoprecipitatie, polymerasekettingreactie en dual-luciferase-reportergentest uitgevoerd om FOXM1-binding aan de prohibitine 2  ( PHB2 ) -promotor te valideren  .

Resultaten:  PINT87aa was necessary verhoogd in het door waterstofperoxide geïnduceerde HCC-celsenescentiemodel. Overexpressie van PINT87aa induceerde groeiremming, cellulaire veroudering en verminderde mitofagie  in vitro  en  in vivo . Daarentegen zou FOXM1 gain-of-function het aandeel senescente HCC-cellen gedeeltelijk kunnen verminderen en de mitofagie kunnen verbeteren. PINT87aa-overexpressie had geen invloed op de expressie van FOXM1 zelf, maar verminderde die van zijn doelwitgenen die betrokken zijn bij celcyclus en proliferatie, met establish  PHB2, die betrokken was bij mitofagie en getranscribeerd door FOXM1. Structurele analyse gaf aan dat PINT87aa kon binden aan het DNA-bindende domein van FOXM1, wat werd bevestigd door co-immunoprecipitatie en immunofluorescentie co-lokalisatie. Verder hebben we aangetoond dat de afgeknotte vorm van 2 tot 39 aminozuren van het peptide effecten uitoefende die vergelijkbaar waren met de volledige vorm.

Conclusie:  Onze studie stelde de rol enormous van PINT87aa als een nieuwe biomarker en een belangrijke regulator van cellulaire veroudering in HCC en identificeerde PINT87aa als een potentieel therapeutisch doelwit voor HCC.

 

 

 

 

 

 

 

 

UCP5 Polyclonal Antibody
ABP60850-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human UCP5 protein Applications tips:
Description: A polyclonal antibody for detection of UCP5 from Human, Mouse. This UCP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP5 protein

UCP5 Polyclonal Antibody
ABP60850-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human UCP5 protein Applications tips:
Description: A polyclonal antibody for detection of UCP5 from Human, Mouse. This UCP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP5 protein

UCP5 Polyclonal Antibody
ABP60850-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human UCP5 protein Applications tips:
Description: A polyclonal antibody for detection of UCP5 from Human, Mouse. This UCP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP5 protein

UCP5 Polyclonal Antibody
ES9457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against UCP5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

UCP5 Polyclonal Antibody
ES9457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against UCP5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- UCP5 antibody
FNab09230	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200-1:1000 Immunogen: solute carrier family 25(mitochondrial carrier, brain), member 14 Uniprot ID: O95258 Research Area: Metabolism
Description: Antibody raised against UCP5

Anti-UCP5 antibody
PAab09230	Lifescience Market	100 ug	EUR 412

Anti-UCP5 antibody
STJ190615	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to UCP5

UCP5 ELISA KIT|Human
EF004049	Lifescience Market	96 Tests	EUR 689

Substance P reversed sequence Peptide
20-abx266314	Abbexa	EUR 495.00 EUR 815.00 EUR 356.00	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Erythropoietin Mimetic Peptide Sequence 20
H-4344.0001	Bachem	1.0mg	EUR 454
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Erythropoietin Mimetic Peptide Sequence 20
H-4344.0005	Bachem	5.0mg	EUR 1723
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

(NANP)5 peptide (repeat-sequence peptide of the P. falciparum circumsporozoite protein, CSP) control/blocking peptide
NANP51-P	Alpha Diagnostics	1 mg	EUR 347

(PPPPNAND)3 peptide (repeat-sequence peptide of the P. berghei circumsporozoite protein, CSP) control/blocking peptide
PPPP321-P	Alpha Diagnostics	100 ug	EUR 164

NET Blocking Peptide (Rat)
30R-AN036	Fitzgerald	100 ug	EUR 241
Description: A synthetic NET Blocking peptide for use as a blocking control in assays to test for specificity of NET antibody, catalog no. 70R-NR004

UCP3 Blocking Peptide (Rat)
30R-AU003	Fitzgerald	100 ug	EUR 256
Description: A synthetic UCP3 Blocking peptide for use as a blocking control in assays to test for specificity of UCP3 antibody, catalog no. 70R-UR005

Rat Calnuc Blocking Peptide
33R-2673	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUCB1 antibody, catalog no. 70R-1118

Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-48T	DL Develop	48T	EUR 467
Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-96T	DL Develop	96T	EUR 605
Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-48Tests	Reddot Biotech	48 Tests	EUR 486

Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-96Tests	Reddot Biotech	96 Tests	EUR 672

Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-48Tests	Reddot Biotech	48 Tests	EUR 465

Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-96Tests	Reddot Biotech	96 Tests	EUR 643

(NVDP)4 peptide (minor repeat-sequence peptide of the P. falciparum circumsporozoite protein, CSP) control/blocking peptide
NVDP41-P	Alpha Diagnostics	100 ug	EUR 164

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

(DRAAGQPAG)3 (repeat-sequence peptide of the P. vivax circumsporozoite protein, CSP) control/blocking peptide
DRAA31-P	Alpha Diagnostics	100 ug	EUR 164

Influenza A virus (H5N1) matrix protein 2 hybrid sequence Control/blocking peptide
M2E11-P	Alpha Diagnostics	100 ug	EUR 164

C-Peptide Blocking Peptide
3277BP-50	Biovision		EUR 153

Rat GTRAP41 Control/blocking peptide
GTRAP41-P	Alpha Diagnostics	100 ug	EUR 164

Rat GTRAP48 Control/blocking peptide
GTRAP48-P	Alpha Diagnostics	100 ug	EUR 164

Rabbit Anti-Rat Uncoupling Protein 5 (UCP5) antiserum # 1
UCP51-S	Alpha Diagnostics	100 ul	EUR 457

BAK1 Blocking Peptide
3031BP-50	Biovision		EUR 153

Bax Blocking Peptide
3032BP-50	Biovision		EUR 153

p53 Blocking Peptide
3036RBP-50	Biovision		EUR 153

RAIDD Blocking Peptide
3037BP-50	Biovision		EUR 153

NFkB Blocking Peptide
3038BP-50	Biovision		EUR 153

FADD Blocking Peptide
3039BP-50	Biovision		EUR 153

PBR Blocking Peptide
3044BP-50	Biovision		EUR 153

MBD4 Blocking Peptide
3056BP-50	Biovision		EUR 153

PRMT7 blocking peptide
3059BP-50	Biovision		EUR 153

DR4 Blocking Peptide
3061BP-50	Biovision		EUR 153

DR5 Blocking Peptide
3062BP-50	Biovision		EUR 153

CD40 Blocking Peptide
3072BP-50	Biovision		EUR 153

Calreticulin Blocking Peptide
3077BP-50	Biovision		EUR 153

PRMT6 Blocking Peptide
3086BP-50	Biovision		EUR 153

TCTN1 Blocking Peptide
3087BP-50	Biovision		EUR 153

TCTN1 Blocking Peptide
3088BP-50	Biovision		EUR 153

KLF4 Blocking Peptide
3089BP-50	Biovision		EUR 153

Lin28 Blocking Peptide
3091BP-50	Biovision		EUR 153

Hsp27 Blocking Peptide
3093BP-50	Biovision		EUR 153

Hsp60 Blocking Peptide
3094RBP-50	Biovision		EUR 153

Hsc70 Blocking Peptide
3095BP-50	Biovision		EUR 153

Hsp70 Blocking Peptide
3097BP-50	Biovision		EUR 153

SIRT7 Blocking Peptide
3099BP-50	Biovision		EUR 153

AT2 Blocking Peptide
30R-AA024	Fitzgerald	100 ug	EUR 241
Description: A synthetic AT2 Blocking peptide for use as a blocking control in assays to test for specificity of AT2 antibody, catalog no. 70R-AR006

UCP3 Blocking Peptide
30R-AU006	Fitzgerald	100 ug	EUR 241
Description: A synthetic UCP3 Blocking peptide for use as a blocking control in assays to test for specificity of UCP3 antibody, catalog no. 20R-UR003

PKA Blocking Peptide
3115BP-50	Biovision		EUR 153

Raf1 Blocking Peptide
3116BP-50	Biovision		EUR 153

Wee1 Blocking Peptide
3120BP-50	Biovision		EUR 153

Stat1 Blocking Peptide
3133RBP-50	Biovision		EUR 153

MAK10 Blocking Peptide
3134BP-50	Biovision		EUR 153

ACADM Blocking Peptide
3137BP-50	Biovision		EUR 153

ACADL Blocking Peptide
3139BP-50	Biovision		EUR 153

ACADSB Blocking Peptide
3150BP-50	Biovision		EUR 153

ACADSB Blocking Peptide
3157BP-50	Biovision		EUR 153

Survivin Blocking Peptide
3160BP-50	Biovision		EUR 153

TXNRD1 Blocking Peptide
7005BP-50	Biovision		EUR 153

EDEM2 Blocking Peptide
6633BP-50	Biovision		EUR 153

SPHKAP Blocking Peptide
6656BP-50	Biovision		EUR 153

USP8 Blocking Peptide
6658BP-50	Biovision		EUR 153

EHHADH Blocking Peptide
6678BP-50	Biovision		EUR 153

ACTH Blocking Peptide
A1051BP-50	Biovision		EUR 153

Secretin Blocking Peptide
A1054BP-50	Biovision		EUR 153

C16orf73 Blocking Peptide
33R-1811	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C16orf73 antibody, catalog no. 70R-4561

ITGBL1 Blocking Peptide
33R-1812	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITGBL1 antibody, catalog no. 70R-1700

C6ORF21 Blocking Peptide
33R-1813	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C6orf21 antibody, catalog no. 70R-1743

PNPLA3 Blocking Peptide
33R-1814	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PNPLA3 antibody, catalog no. 70R-2371

SERPINF2 Blocking Peptide
33R-1815	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SERPINF2 antibody, catalog no. 70R-9700

SLC22A16 Blocking Peptide
33R-1816	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC22A16 antibody, catalog no. 70R-1824

MYLIP Blocking Peptide
33R-1817	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYLIP antibody, catalog no. 70R-2736

PBEF1 Blocking Peptide
33R-1818	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PBEF1 antibody, catalog no. 70R-1027

WNT9B Blocking Peptide
33R-1820	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WNT9B antibody, catalog no. 70R-7246

TM4SF4 Blocking Peptide
33R-1822	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TM4SF4 antibody, catalog no. 70R-7470

ZNF550 Blocking Peptide
33R-1823	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZNF550 antibody, catalog no. 20R-1242

SHROOM2 Blocking Peptide
33R-1824	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SHROOM2 antibody, catalog no. 70R-5079

LOC441964 Blocking Peptide
33R-1825	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LOC441964 antibody, catalog no. 70R-1024

ADRB1 Blocking Peptide
33R-1826	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADRB1 antibody, catalog no. 70R-5939

TCP11 Blocking Peptide
33R-1827	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCP11 antibody, catalog no. 70R-3950

KIF2B Blocking Peptide
33R-1828	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIF2B antibody, catalog no. 70R-5498

RBJ Blocking Peptide
33R-1829	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBJ antibody, catalog no. 70R-5875

MFI2 Blocking Peptide
33R-1830	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MFI2 antibody, catalog no. 70R-10040

UNC84B Blocking Peptide
33R-1831	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UNC84B antibody, catalog no. 70R-6991

CLEC4M Blocking Peptide
33R-1832	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLEC4M antibody, catalog no. 70R-8545

LAYN Blocking Peptide
33R-1833	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LAYN antibody, catalog no. 70R-7484

FKBP5 Blocking Peptide
33R-1834	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP5 antibody, catalog no. 70R-2377

Biocide werkzaamheid van tutine en de invloed ervan op immuuncellen en expressie van groeiremmende en neurogliale peptiden in Mythimna separata (Lepidoptera: Noctuidae)

Mythimna separata Walker (Lepidoptera: Noctuidae) is een van de belangrijkste plagen die ernstige schade aan graangewassen kan veroorzaken. De ontwikkeling van botanische insecticiden met een lage toxiciteit en hoge prestaties wordt de focus van nieuw onderzoek naar pesticiden om M. separata te bestrijden. Tutin, een sesquiterpeenlactonverbinding die wordt verkregen uit Coriaria sinica Maxim, een inheemse Chinese language language giftige plant, heeft een antivoedingsmiddel, absorptie en maagvergiftiging tegen een verscheidenheid aan plagen. Om het toxische impression van tutine op de larven van M. separata te begrijpen, wilden we hun anti-voedingsmiddel, mortaliteit, verlamming, gewichtsverandering bepalen en de verspreiding van M. separata hemocyten onder verschillende concentraties van tutinebehandeling onderzoeken.

Weefselverdeling van het immuun-geassocieerde gengroei-blokkerende peptide (GBP) en neuroglian peptide (Nrg) werd gedetecteerd door reverse transcriptie polymerase kettingreactie (PCR). Verder werd real-time kwantitatieve PCR uitgevoerd om de expressieprofielen van GBP en Nrg te bepalen na verschillende concentraties van tutine-stimulatie. Onze resultaten onthulden dat tutine significante anti-feedant en insecticide activiteiten, verlamming, gewichtsverlies voor M. separata vertoonde . Bovendien had tutine een significante invloed op de morfologie van hemocyten en versterkte het de expressie van GBP en Nrg in M. separata.

Van stress afgeleide reactieve zuurstofsoorten stellen hemocyten in staat om activator van groeiblokkerend peptide (GBP) -verwerkingsenzym af te geven

Insectencytokinegroeiblokkerend peptide (GBP) wordt gesynthetiseerd als een inactieve voorloper, proGBP genaamd, die normaal in een significante concentratie aanwezig is in de hemolymfe van dieren zonder stress (Hayakawa, 1990, 1991). Onder stressomstandigheden wordt proGBP onmiddellijk omgezet tot actief GBP door een serineprotease en males denkt dat dit een belangrijke eerste stap is voor insecten om het hoofd te bieden aan door stress veroorzaakte nadelige effecten by the use of GBP-geïnduceerde fysiologische veranderingen.

Het gedetailleerde mechanisme dat ten grondslag ligt aan de proteolytische verwerking van hemolymfe proGBP bij insecten onder stressomstandigheden blijft echter onbekend. Hier hebben we aangetoond dat proGBP-verwerking door ROS geïnduceerde afgifte van een eiwitachtige concern uit hemocyten vereist die het inactieve proGBP-verwerkingsenzym activeert. De afgifte van het activatoreiwit uit hemocyten wordt geïnitieerd door een verhoging van de cytoplasmatische Ca2 ⁺  -concentratie, geïnduceerd door ROS. Daarom concludeerden we dat door stress geïnduceerde activering van proGBP ROS-afhankelijke stimulatie van een intracellulaire calciumsignaleringsroute in hemocyten vereist, gevolgd door afgifte van de hemocyt-eiwitachtige concern die specifiek het proGBP-verwerkingsenzym activeert.

Lipopolysacharide beïnvloedt het plasma en hersenen farmacokinetiek van subcutaan toegediende HsTX1 [R14a], Okay  _V  1,3-blokkerende peptide

Okay_V1.Three is een spanningsafhankelijk kaliumkanaal dat wordt opgereguleerd bij neuro-inflammatoire aandoeningen, zoals de ziekte van Alzheimer en de ziekte van Parkinson. HsTX1[R14A] is een krachtige en selectieve peptideblokker van Okay_V1.Three met het potentieel om microgliale Okay_V1.Three te blokkeren, maar de opname in de hersenen zal naar verwachting beperkt zijn vanwege de beperkende aard van de bloed-hersenbarrière. Om de perifere en hersenblootstelling te beoordelen , werd een LC-MS/MS-assay ontwikkeld om HsTX1[R14A]-concentraties in muizenplasma en hersenhomogenaat te kwantificeren die betrouwbaar en reproduceerbaar waren in het bereik van 6,7-66,7 nM (r<sup>2< /sup> = 0,9765) en 15-150 pmol/g (r² = 0,9984), respectievelijk.

Om te beoordelen of neuro-inflammatie de HsTX1[R14A]-dispositie beïnvloedde, kregen C57BL/6-muizen HsTX1[R14A] subcutaan (2 mg/kg) 24 uur na een intraperitoneale dosis Escherichia coli lipopolysaccharide (LPS), die vaak wordt gebruikt om neuro-inflammatie te induceren; hersen- en plasmaconcentraties van HsTX1[R14A] werden vervolgens gedurende 120 minuten gekwantificeerd. LPS-behandelingvertraagde de daling van de HsTX1[R14A]-plasmaconcentraties aanzienlijk, vermoedelijk als gevolg van een verminderde renale klaring, en leidde tot een substantiële opname van HsTX1[R14A] in de hersenen, vermoedelijk door verstoring van de inter-endotheliale tight junctions in de hersenen. Deze studie suggereert dat HsTX1[R14A] microglia kan bereiken in voldoende concentraties om Okay_V1.Three te blokkeren bij neuro-inflammatoire aandoeningen, en daarom het potentieel heeft om neurodegeneratieve ziekten te verminderen.

Human Uncoupling Protein 2 (UCP2) Control/blocking peptide #3
UCP23-P	Alpha Diagnostics	100 ug	EUR 164

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
DLR-UCP2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 2, Mitochondrial (UCP2) in samples from tissue homogenates or other biological fluids.

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
DLR-UCP2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 2, Mitochondrial (UCP2) in samples from tissue homogenates or other biological fluids.

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
DLR-UCP2-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 2, Mitochondrial (UCP2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
DLR-UCP2-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 2, Mitochondrial (UCP2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
RDR-UCP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
RDR-UCP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
RDR-UCP2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
RDR-UCP2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
RD-UCP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
RD-UCP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
RD-UCP2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit
RD-UCP2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Substance P reversed sequence Peptide
20-abx266314	Abbexa	EUR 495.00 EUR 815.00 EUR 356.00	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Erythropoietin Mimetic Peptide Sequence 20
H-4344.0001	Bachem	1.0mg	EUR 454
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Erythropoietin Mimetic Peptide Sequence 20
H-4344.0005	Bachem	5.0mg	EUR 1723
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

(NANP)5 peptide (repeat-sequence peptide of the P. falciparum circumsporozoite protein, CSP) control/blocking peptide
NANP51-P	Alpha Diagnostics	1 mg	EUR 347

(PPPPNAND)3 peptide (repeat-sequence peptide of the P. berghei circumsporozoite protein, CSP) control/blocking peptide
PPPP321-P	Alpha Diagnostics	100 ug	EUR 164

Mouse UCP2 shRNA Plasmid
20-abx973302	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UCP2 Recombinant Protein (Mouse)
RP182948	ABM	100 ug	Ask for price

GLUT4 Blocking peptide (Mouse)
30R-AG010	Fitzgerald	100 ug	EUR 241
Description: A synthetic GLUT4 Blocking peptide for use as a blocking control in assays to test for specificity of GLUT4 antibody, catalog no. 70R-GR014

GLUT8 Blocking Peptide (Mouse)
30R-AG011	Fitzgerald	100 ug	EUR 241
Description: A synthetic GLUT8 Blocking peptide for use as a blocking control in assays to test for specificity of GLUT8 antibody, catalog no. 70R-GR008

mouse Splunc2 Blocking Peptide
BF0461-BP	Affbiotech	1mg	EUR 195

Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-48T	DL Develop	48T	EUR 450
Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-96T	DL Develop	96T	EUR 582
Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-48Tests	Reddot Biotech	48 Tests	EUR 465

Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-96Tests	Reddot Biotech	96 Tests	EUR 643

Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-48Tests	Reddot Biotech	48 Tests	EUR 446

Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-96Tests	Reddot Biotech	96 Tests	EUR 615

(NVDP)4 peptide (minor repeat-sequence peptide of the P. falciparum circumsporozoite protein, CSP) control/blocking peptide
NVDP41-P	Alpha Diagnostics	100 ug	EUR 164

UCP2 antibody
20R-UR001	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal UCP2 antibody

UCP2 antibody
70R-21145	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UCP2 antibody

UCP2 Antibody
40280-100ul	SAB	100ul	EUR 252

UCP2 Antibody
1-CSB-PA060040	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

UCP2 Antibody
DF8626	Affbiotech	200ul	EUR 304
Description: UCP2 Antibody detects endogenous levels of total UCP2.

UCP2 Antibody
1-CSB-PA299698	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:10-1:50

UCP2 Antibody
1-CSB-PA032095	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

UCP2 antibody
70R-UR002	Fitzgerald	100 ug	EUR 640
Description: Affinity purified Rabbit polyclonal UCP2 antibody

UCP2 antibody
70R-UR003	Fitzgerald	100 ug	EUR 640
Description: Affinity purified Rabbit polyclonal UCP2 antibody

UCP2 Antibody
1-CSB-PA025555EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

UCP2 Antibody
1-CSB-PA025555GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

UCP2 siRNA
20-abx905933	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UCP2 siRNA
20-abx938928	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UCP2 siRNA
20-abx938929	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UCP2 Antibody
ABD8626	Lifescience Market	100 ug	EUR 438

anti-UCP2
YF-PA15210	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to UCP2

anti-UCP2
YF-PA15211	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to UCP2

anti-UCP2
YF-PA15212	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to UCP2

anti-UCP2
YF-PA15213	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to UCP2

(DRAAGQPAG)3 (repeat-sequence peptide of the P. vivax circumsporozoite protein, CSP) control/blocking peptide
DRAA31-P	Alpha Diagnostics	100 ug	EUR 164

Influenza A virus (H5N1) matrix protein 2 hybrid sequence Control/blocking peptide
M2E11-P	Alpha Diagnostics	100 ug	EUR 164

Mouse Lipin-1 Control/blocking peptide control/blocking peptide #1
LPN11-P	Alpha Diagnostics	100 ug	EUR 164

Mouse Lipin-2 Control/blocking peptide control/blocking peptide #1
LPN21-P	Alpha Diagnostics	100 ug	EUR 164

Mouse Lipin-3 Control/blocking peptide control/blocking peptide #1
LPN31-P	Alpha Diagnostics	100 ug	EUR 164

C-Peptide Blocking Peptide
3277BP-50	Biovision		EUR 153

Ucp2 ORF Vector (Mouse) (pORF)
ORF060984	ABM	1.0 ug DNA	EUR 506

UCP2 ELISA Kit (Mouse) (OKAN05918)
OKAN05918	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

UCP2 ELISA Kit (Mouse) (OKCD08189)
OKCD08189	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat (By similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

UCP2 ELISA Kit (Mouse) (OKEH05261)
OKEH05261	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

Angiopoietin 1 Blocking Peptide (Mouse)
30R-AA012	Fitzgerald	100 ug	EUR 256
Description: A synthetic Angiopoietin 1 Blocking peptide for use as a blocking control in assays to test for specificity of Angiopoietin 1 antibody, catalog no. 70R-AR004

PPAR Delta Blocking Peptide (Mouse)
30R-AC025	Fitzgerald	50 ug	EUR 251
Description: PPAR synthetic control neutralising peptide

Mouse AQP12 control/blocking peptide
AQP125-P	Alpha Diagnostics	100 ug	EUR 152

Mouse CYP1B1 control/blocking peptide
CYP1B12-P	Alpha Diagnostics	100 ug	EUR 164

CLDN6 Mouse mAb Blocking Peptide
BF8001-BP	Affbiotech	1mg	EUR 195

Fibronectin Mouse mAb Blocking Peptide
BF9010-BP	Affbiotech	1mg	EUR 195

HSP70 Mouse mAb Blocking Peptide
BF9012-BP	Affbiotech	1mg	EUR 195

Mouse Agouti Control/blocking peptide
AGO11-P	Alpha Diagnostics	100 ug	EUR 164

Mouse Klotho Control/blocking peptide
KL11-P	Alpha Diagnostics	100 ug	EUR 164

Mouse Moesin control/blocking peptide
MSN11-P	Alpha Diagnostics	100 ug	EUR 164

Anti-UCP2 Antibody
A02256-1	BosterBio	100ug/vial	EUR 294

UCP2 Conjugated Antibody
C40280	SAB	100ul	EUR 397

UCP2 cloning plasmid
CSB-CL025555HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 930 Sequence: atggttgggttcaaggccacagatgtgccccctactgccactgtgaagtttcttggggctggcacagctgcctgcatcgcagatctcatcacctttcctctggatactgctaaagtccggttacagatccaaggagaaagtcaggggccagtgcgcgctacagccagcgcccagta Show more
Description: A cloning plasmid for the UCP2 gene.

UCP2 Rabbit pAb
A4178-100ul	Abclonal	100 ul	EUR 308

UCP2 Rabbit pAb
A4178-200ul	Abclonal	200 ul	EUR 459

UCP2 Rabbit pAb
A4178-20ul	Abclonal	20 ul	EUR 183

UCP2 Rabbit pAb
A4178-50ul	Abclonal	50 ul	EUR 223

UCP2 Polyclonal Antibody
A63760	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

UCP2 Polyclonal Antibody
ABP56476-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human UCP2 Applications tips:
Description: A polyclonal antibody for detection of UCP2 from Human, Mouse, Rat. This UCP2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human UCP2

UCP2 Polyclonal Antibody
ABP56476-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human UCP2 Applications tips:
Description: A polyclonal antibody for detection of UCP2 from Human, Mouse, Rat. This UCP2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human UCP2

UCP2 Polyclonal Antibody
ABP56476-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human UCP2 Applications tips:
Description: A polyclonal antibody for detection of UCP2 from Human, Mouse, Rat. This UCP2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human UCP2

UCP2 Polyclonal Antibody
ES7475-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against UCP2 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

UCP2 Polyclonal Antibody
ES7475-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against UCP2 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

anti- UCP2 antibody
FNab09228	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: uncoupling protein 2(mitochondrial, proton carrier) Uniprot ID: P55851 Gene ID: 7351 Research Area: Metabolism
Description: Antibody raised against UCP2

Anti-UCP2 antibody
PAab09228	Lifescience Market	100 ug	EUR 386

Anti-UCP2 antibody
STJ26031	St John's Laboratory	100 µl	EUR 277
Description: Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'.

Anti-UCP2 antibody
STJ96178	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to UCP2.

Mouse Peptide YY (PYY) control/blocking peptide # 1
PYY11-P	Alpha Diagnostics	100 ug	EUR 164

BAK1 Blocking Peptide
3031BP-50	Biovision		EUR 153

Bax Blocking Peptide
3032BP-50	Biovision		EUR 153

p53 Blocking Peptide
3036RBP-50	Biovision		EUR 153

RAIDD Blocking Peptide
3037BP-50	Biovision		EUR 153

NFkB Blocking Peptide
3038BP-50	Biovision		EUR 153

FADD Blocking Peptide
3039BP-50	Biovision		EUR 153

PBR Blocking Peptide
3044BP-50	Biovision		EUR 153

MBD4 Blocking Peptide
3056BP-50	Biovision		EUR 153

PRMT7 blocking peptide
3059BP-50	Biovision		EUR 153