
Cellulaire veroudering bij hepatocellulair carcinoom

Cellulaire veroudering bij hepatocellulair carcinoom geïnduceerd door een lang niet-coderend RNA-gecodeerd peptide PINT87aa door FOXM1-gemedieerde PHB2 te blokkeren

Rationale:  Onlangs is aangetoond dat lange niet-coderende RNA’s (lncRNA’s), waarvan bekend is dat ze betrokken zijn bij de progressie van kanker bij de mens, coderen voor peptiden met biologische functies, maar de rol van door lncRNA gecodeerde peptiden bij cellulaire veroudering is grotendeels onontgonnen. We rapporteerden eerder de tumor-onderdrukkende rol van PINT87aa, een peptide dat wordt gecodeerd door het lange intergene niet-eiwit coderende RNA, p53-geïnduceerde transcript ( LINC-PINT).  Hier hebben we de rol van PINT87aa bij cellulaire senescentie van hepatocellulair carcinoom (HCC) onderzocht.

Methoden:  We onderzochten de functies van PINT87aa en afgeknotte PINT87aa  in vitro  door celproliferatie te volgen en voerden flowcytometrie uit, senescentie-geassocieerde β-galactosidase-kleuring, JC-1-kleuring die indicatief is voor mitochondriaal membraanpotentieel, de verhouding van het overlappende gebied van lichte keten Three bèta ( LC3B) en mitochondriale sondes en de verhouding van lysosomaal geassocieerd membraaneiwit 1 (LAMP1) overlapt met cytochroom c-oxidase-subeenheid 4I1 (COXIV) die mitofagie aangeeft. PINT87aa en afgeknotte PINT87aa-functies  in vivo werden geverifieerd door subcutaan getransplanteerde tumoren in naakte muizen. De mogelijke binding tussen PINT87aa en forkhead subject M1 (FOXM1) werd voorspeld door middel van structurele analyse en geverifieerd door co-immunoprecipitatie en immunofluorescentie co-lokalisatie. Rescue-experimenten werden  in vivo en in vitro uitgevoerd  na overexpressie van FOXM1. Verder werden chromatine-immunoprecipitatie, polymerasekettingreactie en dual-luciferase-reportergentest uitgevoerd om FOXM1-binding aan de prohibitine 2  ( PHB2 ) -promotor te valideren  .

Resultaten:  PINT87aa was necessary verhoogd in het door waterstofperoxide geïnduceerde HCC-celsenescentiemodel. Overexpressie van PINT87aa induceerde groeiremming, cellulaire veroudering en verminderde mitofagie  in vitro  en  in vivo . Daarentegen zou FOXM1 gain-of-function het aandeel senescente HCC-cellen gedeeltelijk kunnen verminderen en de mitofagie kunnen verbeteren. PINT87aa-overexpressie had geen invloed op de expressie van FOXM1 zelf, maar verminderde die van zijn doelwitgenen die betrokken zijn bij celcyclus en proliferatie, met establish  PHB2, die betrokken was bij mitofagie en getranscribeerd door FOXM1. Structurele analyse gaf aan dat PINT87aa kon binden aan het DNA-bindende domein van FOXM1, wat werd bevestigd door co-immunoprecipitatie en immunofluorescentie co-lokalisatie. Verder hebben we aangetoond dat de afgeknotte vorm van 2 tot 39 aminozuren van het peptide effecten uitoefende die vergelijkbaar waren met de volledige vorm.

Conclusie:  Onze studie stelde de rol enormous van PINT87aa als een nieuwe biomarker en een belangrijke regulator van cellulaire veroudering in HCC en identificeerde PINT87aa als een potentieel therapeutisch doelwit voor HCC.










UCP5 Polyclonal Antibody

ABP60850-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UCP5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UCP5 from Human, Mouse. This UCP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP5 protein

UCP5 Polyclonal Antibody

ABP60850-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UCP5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UCP5 from Human, Mouse. This UCP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP5 protein

UCP5 Polyclonal Antibody

ABP60850-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UCP5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UCP5 from Human, Mouse. This UCP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP5 protein

UCP5 Polyclonal Antibody

ES9457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UCP5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

UCP5 Polyclonal Antibody

ES9457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UCP5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- UCP5 antibody

FNab09230 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: solute carrier family 25(mitochondrial carrier, brain), member 14
  • Uniprot ID: O95258
  • Research Area: Metabolism
Description: Antibody raised against UCP5

Anti-UCP5 antibody

PAab09230 100 ug
EUR 412

Anti-UCP5 antibody

STJ190615 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UCP5


EF004049 96 Tests
EUR 689

Substance P reversed sequence Peptide

  • EUR 495.00
  • EUR 815.00
  • EUR 356.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Erythropoietin Mimetic Peptide Sequence 20

H-4344.0001 1.0mg
EUR 454
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Erythropoietin Mimetic Peptide Sequence 20

H-4344.0005 5.0mg
EUR 1723
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

(NANP)5 peptide (repeat-sequence peptide of the P. falciparum circumsporozoite protein, CSP) control/blocking peptide

NANP51-P 1 mg
EUR 347

(PPPPNAND)3 peptide (repeat-sequence peptide of the P. berghei circumsporozoite protein, CSP) control/blocking peptide

PPPP321-P 100 ug
EUR 164

NET Blocking Peptide (Rat)

30R-AN036 100 ug
EUR 241
Description: A synthetic NET Blocking peptide for use as a blocking control in assays to test for specificity of NET antibody, catalog no. 70R-NR004

UCP3 Blocking Peptide (Rat)

30R-AU003 100 ug
EUR 256
Description: A synthetic UCP3 Blocking peptide for use as a blocking control in assays to test for specificity of UCP3 antibody, catalog no. 70R-UR005

Rat Calnuc Blocking Peptide

33R-2673 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUCB1 antibody, catalog no. 70R-1118

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643

(NVDP)4 peptide (minor repeat-sequence peptide of the P. falciparum circumsporozoite protein, CSP) control/blocking peptide

NVDP41-P 100 ug
EUR 164

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

(DRAAGQPAG)3 (repeat-sequence peptide of the P. vivax circumsporozoite protein, CSP) control/blocking peptide

DRAA31-P 100 ug
EUR 164

Influenza A virus (H5N1) matrix protein 2 hybrid sequence Control/blocking peptide

M2E11-P 100 ug
EUR 164

C-Peptide Blocking Peptide

EUR 153

Rat GTRAP41 Control/blocking peptide

GTRAP41-P 100 ug
EUR 164

Rat GTRAP48 Control/blocking peptide

GTRAP48-P 100 ug
EUR 164

Rabbit Anti-Rat Uncoupling Protein 5 (UCP5) antiserum # 1

UCP51-S 100 ul
EUR 457

BAK1 Blocking Peptide

EUR 153

Bax Blocking Peptide

EUR 153

p53 Blocking Peptide

EUR 153

RAIDD Blocking Peptide

EUR 153

NFkB Blocking Peptide

EUR 153

FADD Blocking Peptide

EUR 153

PBR Blocking Peptide

EUR 153

MBD4 Blocking Peptide

EUR 153

PRMT7 blocking peptide

EUR 153

DR4 Blocking Peptide

EUR 153

DR5 Blocking Peptide

EUR 153

CD40 Blocking Peptide

EUR 153

Calreticulin Blocking Peptide

EUR 153

PRMT6 Blocking Peptide

EUR 153

TCTN1 Blocking Peptide

EUR 153

TCTN1 Blocking Peptide

EUR 153

KLF4 Blocking Peptide

EUR 153

Lin28 Blocking Peptide

EUR 153

Hsp27 Blocking Peptide

EUR 153

Hsp60 Blocking Peptide

EUR 153

Hsc70 Blocking Peptide

EUR 153

Hsp70 Blocking Peptide

EUR 153

SIRT7 Blocking Peptide

EUR 153

AT2 Blocking Peptide

30R-AA024 100 ug
EUR 241
Description: A synthetic AT2 Blocking peptide for use as a blocking control in assays to test for specificity of AT2 antibody, catalog no. 70R-AR006

UCP3 Blocking Peptide

30R-AU006 100 ug
EUR 241
Description: A synthetic UCP3 Blocking peptide for use as a blocking control in assays to test for specificity of UCP3 antibody, catalog no. 20R-UR003

PKA Blocking Peptide

EUR 153

Raf1 Blocking Peptide

EUR 153

Wee1 Blocking Peptide

EUR 153

Stat1 Blocking Peptide

EUR 153

MAK10 Blocking Peptide

EUR 153

ACADM Blocking Peptide

EUR 153

ACADL Blocking Peptide

EUR 153

ACADSB Blocking Peptide

EUR 153

ACADSB Blocking Peptide

EUR 153

Survivin Blocking Peptide

EUR 153

TXNRD1 Blocking Peptide

EUR 153

EDEM2 Blocking Peptide

EUR 153

SPHKAP Blocking Peptide

EUR 153

USP8 Blocking Peptide

EUR 153

EHHADH Blocking Peptide

EUR 153

ACTH Blocking Peptide

EUR 153

Secretin Blocking Peptide

EUR 153

C16orf73 Blocking Peptide

33R-1811 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C16orf73 antibody, catalog no. 70R-4561

ITGBL1 Blocking Peptide

33R-1812 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITGBL1 antibody, catalog no. 70R-1700

C6ORF21 Blocking Peptide

33R-1813 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C6orf21 antibody, catalog no. 70R-1743

PNPLA3 Blocking Peptide

33R-1814 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PNPLA3 antibody, catalog no. 70R-2371

SERPINF2 Blocking Peptide

33R-1815 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SERPINF2 antibody, catalog no. 70R-9700

SLC22A16 Blocking Peptide

33R-1816 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC22A16 antibody, catalog no. 70R-1824

MYLIP Blocking Peptide

33R-1817 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYLIP antibody, catalog no. 70R-2736

PBEF1 Blocking Peptide

33R-1818 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PBEF1 antibody, catalog no. 70R-1027

WNT9B Blocking Peptide

33R-1820 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WNT9B antibody, catalog no. 70R-7246

TM4SF4 Blocking Peptide

33R-1822 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TM4SF4 antibody, catalog no. 70R-7470

ZNF550 Blocking Peptide

33R-1823 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZNF550 antibody, catalog no. 20R-1242

SHROOM2 Blocking Peptide

33R-1824 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SHROOM2 antibody, catalog no. 70R-5079

LOC441964 Blocking Peptide

33R-1825 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LOC441964 antibody, catalog no. 70R-1024

ADRB1 Blocking Peptide

33R-1826 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADRB1 antibody, catalog no. 70R-5939

TCP11 Blocking Peptide

33R-1827 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCP11 antibody, catalog no. 70R-3950

KIF2B Blocking Peptide

33R-1828 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIF2B antibody, catalog no. 70R-5498

RBJ Blocking Peptide

33R-1829 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBJ antibody, catalog no. 70R-5875

MFI2 Blocking Peptide

33R-1830 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MFI2 antibody, catalog no. 70R-10040

UNC84B Blocking Peptide

33R-1831 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UNC84B antibody, catalog no. 70R-6991

CLEC4M Blocking Peptide

33R-1832 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLEC4M antibody, catalog no. 70R-8545

LAYN Blocking Peptide

33R-1833 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LAYN antibody, catalog no. 70R-7484

FKBP5 Blocking Peptide

33R-1834 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP5 antibody, catalog no. 70R-2377

GJB6 Blocking Peptide

33R-1835 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GJB6 antibody, catalog no. 70R-6097

FZD5 Blocking Peptide

33R-1836 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FZD5 antibody, catalog no. 70R-7475

ELMOD1 Blocking Peptide

33R-1837 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ELMOD1 antibody, catalog no. 70R-9490

C9ORF127 Blocking Peptide

33R-1838 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C9orf127 antibody, catalog no. 70R-7095

KIAA0692 Blocking Peptide

33R-1839 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIAA0692 antibody, catalog no. 70R-3254

OR13C5 Blocking Peptide

33R-1840 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OR13C5 antibody, catalog no. 70R-7901

GINS2 Blocking Peptide

33R-1841 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GINS2 antibody, catalog no. 70R-5625

RGS16 Blocking Peptide

33R-1842 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS16 antibody, catalog no. 70R-1260

CACNB2 Blocking Peptide

33R-1843 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CACNB2 antibody, catalog no. 70R-5063

DNER Blocking Peptide

33R-1844 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DNER antibody, catalog no. 20R-1277

RFPL3 Blocking Peptide

33R-1845 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RFPL3 antibody, catalog no. 70R-1162

PENK Blocking Peptide

33R-1846 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PENK antibody, catalog no. 70R-6226

DGKQ Blocking Peptide

33R-1847 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DGKQ antibody, catalog no. 70R-9133

NUDC Blocking Peptide

33R-1848 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUDC antibody, catalog no. 70R-5520

PABPC5 Blocking Peptide

33R-1849 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PABPC5 antibody, catalog no. 70R-4840

TRAF1 Blocking Peptide

33R-1850 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAF1 antibody, catalog no. 70R-10512

ZPLD1 Blocking Peptide

33R-1851 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZPLD1 antibody, catalog no. 70R-7542

SREBF1 Blocking Peptide

33R-1852 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SREBF1 antibody, catalog no. 70R-10526

ATG4A Blocking Peptide

33R-1853 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG4A antibody, catalog no. 70R-2866

KRT14 Blocking Peptide

33R-1854 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KRT14 antibody, catalog no. 20R-1352

POLDIP3 Blocking Peptide

33R-1855 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLDIP3 antibody, catalog no. 70R-4847

SRGAP1 Blocking Peptide

33R-1856 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRGAP1 antibody, catalog no. 70R-9502

CYLC2 Blocking Peptide

33R-1857 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CYLC2 antibody, catalog no. 70R-2744

DKKL1 Blocking Peptide

33R-1858 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKKL1 antibody, catalog no. 70R-7515

CHD1L Blocking Peptide

33R-1859 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHD1L antibody, catalog no. 70R-1304

MYH9 Blocking Peptide

33R-1860 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYH9 antibody, catalog no. 70R-2739

PTTG2 Blocking Peptide

33R-1861 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PTTG2 antibody, catalog no. 70R-8929

NFKBIE Blocking Peptide

33R-1862 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NFKBIE antibody, catalog no. 70R-8262

TMEM9 Blocking Peptide

33R-1863 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM9 antibody, catalog no. 70R-7412

CAPS Blocking Peptide

33R-1864 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CAPS antibody, catalog no. 70R-5864

RAD54B Blocking Peptide

33R-1865 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD54B antibody, catalog no. 70R-5648

OASL Blocking Peptide

33R-1866 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OASL antibody, catalog no. 70R-5891

DMAP1 Blocking Peptide

33R-1867 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DMAP1 antibody, catalog no. 20R-1081

IGFALS Blocking Peptide

33R-1869 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IGFALS antibody, catalog no. 70R-6072

GPX3 Blocking Peptide

33R-1870 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GPX3 antibody, catalog no. 70R-5305

THG1L Blocking Peptide

33R-1871 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of THG1L antibody, catalog no. 70R-3535

CCT5 Blocking Peptide

33R-1872 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCT5 antibody, catalog no. 70R-3888

MBD2 Blocking Peptide

33R-1873 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MBD2 antibody, catalog no. 70R-1031

KIF2B Blocking Peptide

33R-1874 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIF2B antibody, catalog no. 70R-5604

NANOS1 Blocking Peptide

33R-1875 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NANOS1 antibody, catalog no. 70R-4987

ZNF280C Blocking Peptide

33R-1876 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZNF280C antibody, catalog no. 70R-8333

Zfp161 Blocking Peptide

33R-1877 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Zfp161 antibody, catalog no. 70R-7991

SSR1 Blocking Peptide

33R-1878 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SSR1 antibody, catalog no. 70R-7311

LOC153222 Blocking Peptide

33R-1879 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LOC153222 antibody, catalog no. 70R-7905

ASB12 Blocking Peptide

33R-1880 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASB12 antibody, catalog no. 70R-5841

NID2 Blocking Peptide

33R-1881 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NID2 antibody, catalog no. 70R-6064

ABCF3 Blocking Peptide

33R-1883 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABCF3 antibody, catalog no. 70R-6278

SLC5A7 Blocking Peptide

33R-1884 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC5A7 antibody, catalog no. 70R-7211

HAO2 Blocking Peptide

33R-1885 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HAO2 antibody, catalog no. 70R-2913

Katna1 Blocking Peptide

33R-1887 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Katna1 antibody, catalog no. 70R-9162

C6ORF134 Blocking Peptide

33R-1888 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C6orf134 antibody, catalog no. 70R-3866

CPSF3 Blocking Peptide

33R-1889 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CPSF3 antibody, catalog no. 70R-1351

FBXO3 Blocking Peptide

33R-1890 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXO3 antibody, catalog no. 70R-2790

MPDZ Blocking Peptide

33R-1891 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MPDZ antibody, catalog no. 70R-2266

ARHGDIG Blocking Peptide

33R-1892 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARHGDIG antibody, catalog no. 70R-6038

PDXDC1 Blocking Peptide

33R-1893 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDXDC1 antibody, catalog no. 70R-4233

LDLRAD1 Blocking Peptide

33R-1894 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDLRAD1 antibody, catalog no. 70R-6670

TAF7L Blocking Peptide

33R-1895 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TAF7L antibody, catalog no. 20R-1157

POLR3GL Blocking Peptide

33R-1896 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLR3GL antibody, catalog no. 70R-10078

LDLRAD3 Blocking Peptide

33R-1897 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDLRAD3 antibody, catalog no. 70R-9224

ZGPAT Blocking Peptide

33R-1898 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZGPAT antibody, catalog no. 70R-3509

Mcm10 Blocking Peptide

33R-1899 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Mcm10 antibody, catalog no. 70R-8186

HSPA1L Blocking Peptide

33R-1900 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPA1L antibody, catalog no. 70R-4431

SNRPN Blocking Peptide

33R-1901 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SNRPN antibody, catalog no. 70R-8478

DHRSX Blocking Peptide

33R-1902 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DHRSX antibody, catalog no. 70R-7875

TTC33 Blocking Peptide

33R-1903 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TTC33 antibody, catalog no. 70R-3754

CTAGE5 Blocking Peptide

33R-1904 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CTAGE5 antibody, catalog no. 70R-7102

CPEB4 Blocking Peptide

33R-1905 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CPEB4 antibody, catalog no. 70R-4969

FSIP1 Blocking Peptide

33R-1906 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FSIP1 antibody, catalog no. 70R-3397

DDX27 Blocking Peptide

33R-1907 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX27 antibody, catalog no. 70R-1385

ADD3 Blocking Peptide

33R-1908 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADD3 antibody, catalog no. 70R-9940

Biocide werkzaamheid van tutine en de invloed ervan op immuuncellen en expressie van groeiremmende en neurogliale peptiden in Mythimna separata (Lepidoptera: Noctuidae)

Mythimna separata Walker (Lepidoptera: Noctuidae) is een van de belangrijkste plagen die ernstige schade aan graangewassen kan veroorzaken. De ontwikkeling van botanische insecticiden met een lage toxiciteit en hoge prestaties wordt de focus van nieuw onderzoek naar pesticiden om M. separata te bestrijden. Tutin, een sesquiterpeenlactonverbinding die wordt verkregen uit Coriaria sinica Maxim, een inheemse Chinese language language giftige plant, heeft een antivoedingsmiddel, absorptie en maagvergiftiging tegen een verscheidenheid aan plagen. Om het toxische impression van tutine op de larven van M. separata te begrijpen, wilden we hun anti-voedingsmiddel, mortaliteit, verlamming, gewichtsverandering bepalen en de verspreiding van M. separata hemocyten onder verschillende concentraties van tutinebehandeling onderzoeken.

Weefselverdeling van het immuun-geassocieerde gengroei-blokkerende peptide (GBP) en neuroglian peptide (Nrg) werd gedetecteerd door reverse transcriptie polymerase kettingreactie (PCR). Verder werd real-time kwantitatieve PCR uitgevoerd om de expressieprofielen van GBP en Nrg te bepalen na verschillende concentraties van tutine-stimulatie. Onze resultaten onthulden dat tutine significante anti-feedant en insecticide activiteiten, verlamming, gewichtsverlies voor M. separata vertoonde . Bovendien had tutine een significante invloed op de morfologie van hemocyten en versterkte het de expressie van GBP en Nrg in M. separata.

Van stress afgeleide reactieve zuurstofsoorten stellen hemocyten in staat om activator van groeiblokkerend peptide (GBP) -verwerkingsenzym af te geven

Insectencytokinegroeiblokkerend peptide (GBP) wordt gesynthetiseerd als een inactieve voorloper, proGBP genaamd, die normaal in een significante concentratie aanwezig is in de hemolymfe van dieren zonder stress (Hayakawa, 1990, 1991). Onder stressomstandigheden wordt proGBP onmiddellijk omgezet tot actief GBP door een serineprotease en males denkt dat dit een belangrijke eerste stap is voor insecten om het hoofd te bieden aan door stress veroorzaakte nadelige effecten by the use of GBP-geïnduceerde fysiologische veranderingen.

Het gedetailleerde mechanisme dat ten grondslag ligt aan de proteolytische verwerking van hemolymfe proGBP bij insecten onder stressomstandigheden blijft echter onbekend. Hier hebben we aangetoond dat proGBP-verwerking door ROS geïnduceerde afgifte van een eiwitachtige concern uit hemocyten vereist die het inactieve proGBP-verwerkingsenzym activeert. De afgifte van het activatoreiwit uit hemocyten wordt geïnitieerd door een verhoging van de cytoplasmatische Ca2 +  -concentratie, geïnduceerd door ROS. Daarom concludeerden we dat door stress geïnduceerde activering van proGBP ROS-afhankelijke stimulatie van een intracellulaire calciumsignaleringsroute in hemocyten vereist, gevolgd door afgifte van de hemocyt-eiwitachtige concern die specifiek het proGBP-verwerkingsenzym activeert.

Lipopolysacharide beïnvloedt het plasma en hersenen farmacokinetiek van subcutaan toegediende HsTX1 [R14a], Okay  V  1,3-blokkerende peptide

Okay<sub>V</sub>1.Three is een spanningsafhankelijk kaliumkanaal dat wordt opgereguleerd bij neuro-inflammatoire aandoeningen, zoals de ziekte van Alzheimer en de ziekte van Parkinson. HsTX1[R14A] is een krachtige en selectieve peptideblokker van Okay<sub>V</sub>1.Three met het potentieel om microgliale Okay<sub>V</sub>1.Three te blokkeren, maar de opname in de hersenen zal naar verwachting beperkt zijn vanwege de beperkende aard van de bloed-hersenbarrière. Om de perifere en hersenblootstelling te beoordelen , werd een LC-MS/MS-assay ontwikkeld om HsTX1[R14A]-concentraties in muizenplasma en hersenhomogenaat te kwantificeren die betrouwbaar en reproduceerbaar waren in het bereik van 6,7-66,7 nM (r<sup>2< /sup> = 0,9765) en 15-150 pmol/g (r<sup>2</sup> = 0,9984), respectievelijk.

Om te beoordelen of neuro-inflammatie de HsTX1[R14A]-dispositie beïnvloedde, kregen C57BL/6-muizen HsTX1[R14A] subcutaan (2 mg/kg) 24 uur na een intraperitoneale dosis Escherichia coli lipopolysaccharide (LPS), die vaak wordt gebruikt om neuro-inflammatie te induceren; hersen- en plasmaconcentraties van HsTX1[R14A] werden vervolgens gedurende 120 minuten gekwantificeerd. LPS-behandelingvertraagde de daling van de HsTX1[R14A]-plasmaconcentraties aanzienlijk, vermoedelijk als gevolg van een verminderde renale klaring, en leidde tot een substantiële opname van HsTX1[R14A] in de hersenen, vermoedelijk door verstoring van de inter-endotheliale tight junctions in de hersenen. Deze studie suggereert dat HsTX1[R14A] microglia kan bereiken in voldoende concentraties om Okay<sub>V</sub>1.Three te blokkeren bij neuro-inflammatoire aandoeningen, en daarom het potentieel heeft om neurodegeneratieve ziekten te verminderen.

Human Uncoupling Protein 2 (UCP2) Control/blocking peptide #3

UCP23-P 100 ug
EUR 164

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

DLR-UCP2-Hu-48T 48T
EUR 517
  • Should the Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 2, Mitochondrial (UCP2) in samples from tissue homogenates or other biological fluids.

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

DLR-UCP2-Hu-96T 96T
EUR 673
  • Should the Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 2, Mitochondrial (UCP2) in samples from tissue homogenates or other biological fluids.

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

DLR-UCP2-Ra-48T 48T
EUR 549
  • Should the Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 2, Mitochondrial (UCP2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

DLR-UCP2-Ra-96T 96T
EUR 718
  • Should the Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 2, Mitochondrial (UCP2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

RDR-UCP2-Hu-48Tests 48 Tests
EUR 544

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

RDR-UCP2-Hu-96Tests 96 Tests
EUR 756

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

RDR-UCP2-Ra-48Tests 48 Tests
EUR 583

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

RDR-UCP2-Ra-96Tests 96 Tests
EUR 811

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

RD-UCP2-Hu-48Tests 48 Tests
EUR 521

Human Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

RD-UCP2-Hu-96Tests 96 Tests
EUR 723

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

RD-UCP2-Ra-48Tests 48 Tests
EUR 557

Rat Uncoupling Protein 2, Mitochondrial (UCP2) ELISA Kit

RD-UCP2-Ra-96Tests 96 Tests
EUR 775

Erythropoietin Mimetic Peptide Sequence 20

H-4344.0001 1.0mg
EUR 454
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Erythropoietin Mimetic Peptide Sequence 20

H-4344.0005 5.0mg
EUR 1723
Description: Sum Formula: C72H99N17O17S2; CAS# [203397-62-0] net

Substance P reversed sequence Peptide

  • EUR 495.00
  • EUR 815.00
  • EUR 356.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

(NANP)5 peptide (repeat-sequence peptide of the P. falciparum circumsporozoite protein, CSP) control/blocking peptide

NANP51-P 1 mg
EUR 347

(PPPPNAND)3 peptide (repeat-sequence peptide of the P. berghei circumsporozoite protein, CSP) control/blocking peptide

PPPP321-P 100 ug
EUR 164

Mouse UCP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UCP2 Recombinant Protein (Mouse)

RP182948 100 ug Ask for price

mouse Splunc2 Blocking Peptide

BF0461-BP 1mg
EUR 195

GLUT4 Blocking peptide (Mouse)

30R-AG010 100 ug
EUR 241
Description: A synthetic GLUT4 Blocking peptide for use as a blocking control in assays to test for specificity of GLUT4 antibody, catalog no. 70R-GR014

GLUT8 Blocking Peptide (Mouse)

30R-AG011 100 ug
EUR 241
Description: A synthetic GLUT8 Blocking peptide for use as a blocking control in assays to test for specificity of GLUT8 antibody, catalog no. 70R-GR008

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643

(NVDP)4 peptide (minor repeat-sequence peptide of the P. falciparum circumsporozoite protein, CSP) control/blocking peptide

NVDP41-P 100 ug
EUR 164


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UCP2 antibody

70R-21145 50 ul
EUR 435
Description: Rabbit polyclonal UCP2 antibody

UCP2 antibody

70R-UR002 100 ug
EUR 640
Description: Affinity purified Rabbit polyclonal UCP2 antibody

UCP2 antibody

70R-UR003 100 ug
EUR 640
Description: Affinity purified Rabbit polyclonal UCP2 antibody

UCP2 Antibody

ABD8626 100 ug
EUR 438

UCP2 Antibody

40280-100ul 100ul
EUR 252

UCP2 antibody

20R-UR001 100 ug
EUR 673
Description: Rabbit polyclonal UCP2 antibody

UCP2 Antibody

DF8626 200ul
EUR 304
Description: UCP2 Antibody detects endogenous levels of total UCP2.

UCP2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:10-1:50

UCP2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

UCP2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

UCP2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

UCP2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UCP2. Recognizes UCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


YF-PA15210 50 ug
EUR 363
Description: Mouse polyclonal to UCP2


YF-PA15211 50 ug
EUR 363
Description: Mouse polyclonal to UCP2


YF-PA15212 50 ug
EUR 363
Description: Mouse polyclonal to UCP2


YF-PA15213 100 ug
EUR 403
Description: Rabbit polyclonal to UCP2

Influenza A virus (H5N1) matrix protein 2 hybrid sequence Control/blocking peptide

M2E11-P 100 ug
EUR 164

(DRAAGQPAG)3 (repeat-sequence peptide of the P. vivax circumsporozoite protein, CSP) control/blocking peptide

DRAA31-P 100 ug
EUR 164

Mouse Lipin-1 Control/blocking peptide control/blocking peptide #1

LPN11-P 100 ug
EUR 164

Mouse Lipin-2 Control/blocking peptide control/blocking peptide #1

LPN21-P 100 ug
EUR 164

Mouse Lipin-3 Control/blocking peptide control/blocking peptide #1

LPN31-P 100 ug
EUR 164

C-Peptide Blocking Peptide

EUR 153

Ucp2 ORF Vector (Mouse) (pORF)

ORF060984 1.0 ug DNA
EUR 506

UCP2 ELISA Kit (Mouse) (OKAN05918)

OKAN05918 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

UCP2 ELISA Kit (Mouse) (OKCD08189)

OKCD08189 96 Wells
EUR 1001
Description: Description of target: UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat (By similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

UCP2 ELISA Kit (Mouse) (OKEH05261)

OKEH05261 96 Wells
EUR 662
Description: Description of target: UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

Mouse Agouti Control/blocking peptide

AGO11-P 100 ug
EUR 164

Mouse AQP12 control/blocking peptide

AQP125-P 100 ug
EUR 152

CLDN6 Mouse mAb Blocking Peptide

BF8001-BP 1mg
EUR 195

Fibronectin Mouse mAb Blocking Peptide

BF9010-BP 1mg
EUR 195

HSP70 Mouse mAb Blocking Peptide

BF9012-BP 1mg
EUR 195

Angiopoietin 1 Blocking Peptide (Mouse)

30R-AA012 100 ug
EUR 256
Description: A synthetic Angiopoietin 1 Blocking peptide for use as a blocking control in assays to test for specificity of Angiopoietin 1 antibody, catalog no. 70R-AR004

PPAR Delta Blocking Peptide (Mouse)

30R-AC025 50 ug
EUR 251
Description: PPAR synthetic control neutralising peptide

Mouse CYP1B1 control/blocking peptide

CYP1B12-P 100 ug
EUR 164

Mouse Moesin control/blocking peptide

MSN11-P 100 ug
EUR 164

Mouse Klotho Control/blocking peptide

KL11-P 100 ug
EUR 164

UCP2 Conjugated Antibody

C40280 100ul
EUR 397

UCP2 cloning plasmid

CSB-CL025555HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 930
  • Sequence: atggttgggttcaaggccacagatgtgccccctactgccactgtgaagtttcttggggctggcacagctgcctgcatcgcagatctcatcacctttcctctggatactgctaaagtccggttacagatccaaggagaaagtcaggggccagtgcgcgctacagccagcgcccagta
  • Show more
Description: A cloning plasmid for the UCP2 gene.

anti- UCP2 antibody

FNab09228 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: uncoupling protein 2(mitochondrial, proton carrier)
  • Uniprot ID: P55851
  • Gene ID: 7351
  • Research Area: Metabolism
Description: Antibody raised against UCP2

UCP2 Polyclonal Antibody

ES7475-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UCP2 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

UCP2 Polyclonal Antibody

ES7475-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UCP2 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

UCP2 Polyclonal Antibody

ABP56476-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human UCP2
  • Applications tips:
Description: A polyclonal antibody for detection of UCP2 from Human, Mouse, Rat. This UCP2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human UCP2

UCP2 Polyclonal Antibody

ABP56476-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human UCP2
  • Applications tips:
Description: A polyclonal antibody for detection of UCP2 from Human, Mouse, Rat. This UCP2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human UCP2

UCP2 Polyclonal Antibody

ABP56476-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human UCP2
  • Applications tips:
Description: A polyclonal antibody for detection of UCP2 from Human, Mouse, Rat. This UCP2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human UCP2

UCP2 Polyclonal Antibody

A63760 100 µg
EUR 570.55
Description: fast delivery possible

Anti-UCP2 Antibody

A02256-1 100ug/vial
EUR 294

UCP2 Rabbit pAb

A4178-100ul 100 ul
EUR 308

UCP2 Rabbit pAb

A4178-200ul 200 ul
EUR 459

UCP2 Rabbit pAb

A4178-20ul 20 ul
EUR 183

UCP2 Rabbit pAb

A4178-50ul 50 ul
EUR 223

Anti-UCP2 antibody

PAab09228 100 ug
EUR 386

Anti-UCP2 antibody

STJ96178 200 µl
EUR 197
Description: Rabbit polyclonal to UCP2.

Anti-UCP2 antibody

STJ26031 100 µl
EUR 277
Description: Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'.

Mouse Peptide YY (PYY) control/blocking peptide # 1

PYY11-P 100 ug
EUR 164

AXL Blocking Peptide

AF8412-BP 1mg
EUR 195

MUC1 Blocking Peptide

AF8524-BP 1mg
EUR 195

A1Up Blocking Peptide

AF9002-BP 1mg
EUR 195

Acrosin Blocking Peptide

AF9003-BP 1mg
EUR 195

AIFL Blocking Peptide

AF9005-BP 1mg
EUR 195

AMPKgamma2 Blocking Peptide

AF9006-BP 1mg
EUR 195

ANKRD20 Blocking Peptide

AF9008-BP 1mg
EUR 195

APOBEC3A Blocking Peptide

AF9009-BP 1mg
EUR 195

ApoOL Blocking Peptide

AF9010-BP 1mg
EUR 195

ARHGAP1 Blocking Peptide

AF9011-BP 1mg
EUR 195

ARHGAP22 Blocking Peptide

AF9012-BP 1mg
EUR 195

ARHGEF19 Blocking Peptide

AF9013-BP 1mg
EUR 195

ARMCX1 Blocking Peptide

AF9014-BP 1mg
EUR 195

Arrdc1 Blocking Peptide

AF9016-BP 1mg
EUR 195

ARRDC2 Blocking Peptide

AF9017-BP 1mg
EUR 195

Arrdc4 Blocking Peptide

AF9018-BP 1mg
EUR 195

ASF1B Blocking Peptide

AF9022-BP 1mg
EUR 195

BAM32 Blocking Peptide

AF9023-BP 1mg
EUR 195

BEGAIN Blocking Peptide

AF9024-BP 1mg
EUR 195

BRD3 Blocking Peptide

AF9025-BP 1mg
EUR 195

BTBD6 Blocking Peptide

AF9026-BP 1mg
EUR 195

Cables2 Blocking Peptide

AF9029-BP 1mg
EUR 195

CaMKIbeta Blocking Peptide

AF9031-BP 1mg
EUR 195

CAS Blocking Peptide

AF9032-BP 1mg
EUR 195

CD158f2 Blocking Peptide

AF9037-BP 1mg
EUR 195

CD32 Blocking Peptide

AF9038-BP 1mg
EUR 195

Cdc16 Blocking Peptide

AF9039-BP 1mg
EUR 195

Centrobin Blocking Peptide

AF9040-BP 1mg
EUR 195

CEP152 Blocking Peptide

AF9041-BP 1mg
EUR 195

CMTM4 Blocking Peptide

AF9042-BP 1mg
EUR 195

CNOT2 Blocking Peptide

AF9043-BP 1mg
EUR 195

COL19A1 Blocking Peptide

AF9044-BP 1mg
EUR 195

COL4A6 Blocking Peptide

AF9045-BP 1mg
EUR 195

COL5A3 Blocking Peptide

AF9046-BP 1mg
EUR 195

CRSP130 Blocking Peptide

AF9049-BP 1mg
EUR 195

CYB561D1 Blocking Peptide

AF9050-BP 1mg
EUR 195

CYP4F2 Blocking Peptide

AF9051-BP 1mg
EUR 195

Eg5 Blocking Peptide

AF9058-BP 1mg
EUR 195

Eps8L3 Blocking Peptide

AF9061-BP 1mg
EUR 195

eRF3a Blocking Peptide

AF9062-BP 1mg
EUR 195

ETL Blocking Peptide

AF9063-BP 1mg
EUR 195

FAM80B Blocking Peptide

AF9064-BP 1mg
EUR 195

FBP3 Blocking Peptide

AF9065-BP 1mg
EUR 195

FoxR1 Blocking Peptide

AF9067-BP 1mg
EUR 195

GAAP Blocking Peptide

AF9068-BP 1mg
EUR 195

GALR3 Blocking Peptide

AF9069-BP 1mg
EUR 195

GAS3 Blocking Peptide

AF9070-BP 1mg
EUR 195

GBP4 Blocking Peptide

AF9071-BP 1mg
EUR 195

GPR124 Blocking Peptide

AF9073-BP 1mg
EUR 195

GPR139 Blocking Peptide

AF9074-BP 1mg
EUR 195

GPR41 Blocking Peptide

AF9075-BP 1mg
EUR 195

GPR50 Blocking Peptide

AF9076-BP 1mg
EUR 195

GPRC5C Blocking Peptide

AF9077-BP 1mg
EUR 195

Grap Blocking Peptide

AF9079-BP 1mg
EUR 195

GRB10 Blocking Peptide

AF9080-BP 1mg
EUR 195

GRIN2 Blocking Peptide

AF9081-BP 1mg
EUR 195

GS28 Blocking Peptide

AF9082-BP 1mg
EUR 195

HABP2 Blocking Peptide

AF9083-BP 1mg
EUR 195

HORMAD1 Blocking Peptide

AF9088-BP 1mg
EUR 195

HoxD10 Blocking Peptide

AF9089-BP 1mg
EUR 195

HoxD8 Blocking Peptide

AF9090-BP 1mg
EUR 195

HRT2 Blocking Peptide

AF9092-BP 1mg
EUR 195

INTS2 Blocking Peptide

AF9098-BP 1mg
EUR 195

KCNT1 Blocking Peptide

AF9099-BP 1mg
EUR 195

KIF13B Blocking Peptide

AF9100-BP 1mg
EUR 195

KIR3.1 Blocking Peptide

AF9101-BP 1mg
EUR 195

KIR3.4 Blocking Peptide

AF9102-BP 1mg
EUR 195

LHR Blocking Peptide

AF9104-BP 1mg
EUR 195

LONP2 Blocking Peptide

AF9105-BP 1mg
EUR 195

LRP10 Blocking Peptide

AF9106-BP 1mg
EUR 195

LUC7L2 Blocking Peptide

AF9107-BP 1mg
EUR 195

Matriptase Blocking Peptide

AF9109-BP 1mg
EUR 195

MCT12 Blocking Peptide

AF9110-BP 1mg
EUR 195

ME2 Blocking Peptide

AF9111-BP 1mg
EUR 195

MINK1 Blocking Peptide

AF9112-BP 1mg
EUR 195

Mob3C Blocking Peptide

AF9114-BP 1mg
EUR 195

MPP1 Blocking Peptide

AF9115-BP 1mg
EUR 195

MRCKbeta Blocking Peptide

AF9116-BP 1mg
EUR 195

MRGF Blocking Peptide

AF9117-BP 1mg
EUR 195

NDUFS5 Blocking Peptide

AF9124-BP 1mg
EUR 195

Nek9 Blocking Peptide

AF9125-BP 1mg
EUR 195

NFATc2IP Blocking Peptide

AF9128-BP 1mg
EUR 195

NFRKB Blocking Peptide

AF9129-BP 1mg
EUR 195

Nicalin Blocking Peptide

AF9130-BP 1mg
EUR 195

Nidogen Blocking Peptide

AF9131-BP 1mg
EUR 195

NIPA Blocking Peptide

AF9132-BP 1mg
EUR 195

NMUR1 Blocking Peptide

AF9133-BP 1mg
EUR 195

Nox3 Blocking Peptide

AF9134-BP 1mg
EUR 195

NRIP3 Blocking Peptide

AF9135-BP 1mg
EUR 195

OMG Blocking Peptide

AF9146-BP 1mg
EUR 195

OTUB2 Blocking Peptide

AF9147-BP 1mg
EUR 195

Oxr1 Blocking Peptide

AF9148-BP 1mg
EUR 195

PDE10A Blocking Peptide

AF9150-BP 1mg
EUR 195

PEG3 Blocking Peptide

AF9152-BP 1mg
EUR 195

Peropsin Blocking Peptide

AF9153-BP 1mg
EUR 195

PHF3 Blocking Peptide

AF9154-BP 1mg
EUR 195

PHKB Blocking Peptide

AF9156-BP 1mg
EUR 195

PIG3 Blocking Peptide

AF9159-BP 1mg
EUR 195

PIPOX Blocking Peptide

AF9160-BP 1mg
EUR 195

PLA1A Blocking Peptide

AF9162-BP 1mg
EUR 195

Pmp24 Blocking Peptide

AF9163-BP 1mg
EUR 195

PNPase Blocking Peptide

AF9164-BP 1mg
EUR 195

POLR3B Blocking Peptide

AF9165-BP 1mg
EUR 195

POLR3E Blocking Peptide

AF9166-BP 1mg
EUR 195

Leave a Reply

Your email address will not be published. Required fields are marked *